Deteksi dan Identifikasi Chrysanthemum Stunt Viroid pada Tanaman Krisan Menggunakan Teknik Reverse Transcriptase Polymerase Chain Reaction (Detection and Identification of Chrysanthemum Stunt Viroid on Chrysanthemum Using Reverse Transcriptase Polymerase

Erniawati Diningsih, I gede Suastika, Yoyoh Sulyo, Budi Winarto

Abstract


Chrysanthemum stunt viroid (CSVd) merupakan salah satu viroid yang menginfeksi tanaman krisan di Indonesia. Tujuan penelitian ialah untuk mengembangkan metode deteksi CSVd secara molekuler dan mengkarakterisasi CSVd isolat Indonesia. Penelitian dilaksanakan di Laboratorium Virologi Tumbuhan, Departemen Proteksi Tanaman, Institut Pertanian Bogor, dan Rumah Kaca serta Laboratorium Virologi, Balai Penelitian Tanaman Hias, Segunung, Cianjur, Jawa Barat, dari Bulan Mei 2007 sampai dengan Juni 2008. RNA total diekstraksi dari daun tanaman krisan yang dihasilkan di rumah kaca menggunakan rneasy plant mini kits. Genom CSVd diamplifikasi dengan pasangan primer 5’-CAACTGAAGCTTCAACGCCTT-3’ dan 5’-AGGATTACTCCT- GTCTCGCA-3’. Suatu fragmen dengan ukuran 250 bp mengindikasikan bahwa c-DNA CSVd berhasil diamplifikasi dari tanaman krisan sakit menggunakan teknik RT-PCR. Urutan cDNA dari salah satu CSVd isolat Indonesia berhasil ditemukan dengan urutan sebagai berikut: cttaggattactcctgtctcgcaggagtggggtcctaagcctcattcga ttgcgcg aatctcgtcgtgcacttcctccagggatttccccgggggataccctgtaag- gaacttcttcgcctcatttcttttaagcagcagggttcaggagtgcaccacaggaaccacaagtaagtcccgagggaacaaaactaaggttccacgggcttactccctagcccaggtag- gctaaagaagattggaa. Urutan basa-basa tersebut memiliki tingkat kesamaan yang tinggi dengan sekuen nukleotida isolat CSVd dari Jepang, Korea, India, dan Amerika.

 


Keywords


Chrysanthemum stunt viroid (CSVd); Reverse transcriptase polymerase chain reaction; Dendranthema grandiflora Kitam; DNA sequencing

Full Text:

PDF


DOI: http://dx.doi.org/10.21082/jhort.v23n1.2013.p1-8

Refbacks

  • There are currently no refbacks.
';



Copyright (c) 2015 Indonesian Center for Horticulture Research and Development

Creative Commons License
This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

 


Jurnal Hortikultura (J.Hort) has been indexed :

         

===================================================================================================================

 Creative Commons License
Junal Hortikultura is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.
Based on a work at http://ejurnal.litbang.pertanian.go.id/index.php/jhort
Permissions beyond the scope of this license may be available at www.litbang.pertanian.go.id.

Indonesian Center for Horticulture Research and Development

Jl. Tentara Pelajar No. 3C Kampus Penelitian Pertanian Cimanggu Bogor 16124, Indonesia
Telp.  +62 251-8372096, 7565366, (Ext. 324) (Hunting System)
Faks.  +62 251-8387651, 8575664, 8372096
E-mail: redaksi.jhorti@gmail.com

ISSN: 0853-7097
E-ISSN: 2502-5120

 

free web stats

View My Stats